------------- Protein Synthesis/DNA ------------

-DECODE DNA BELOW-

GOOD LUCK!

ACTGGTACCACCCGAACGTTAATCACGGGAACAGACCTATGTATAACTATATCTAAGC

Historical Influences on Charles Darwin

Thomas Robert Malthus 

Feb. 14, 1766-Dec. 29, 1834
   Thomas Robert Malthus was an economist for Britain and I believe tremendously influenced the ideas that contributed to the studies of Charles Darwin. Malthus who is best known for his theory that the growth of population will always outgrow the growth of the food supply. He was the first man to publicly predicted the limits of the human population. Malthus believed that if society became over populated, it would reach a point to where the reproduction of the population would over pass the production of food to feed the society causing death and disease. Malthus also believed that "man" is lazy. In a sense that "man" feels that his duty is to provide for his family and make sure food is on the table. If a man works just to be able to have food every night that he will be satisfied and get complacent and not feel the need to work harder because he is meeting his needs and views. His idea of population growth wasn't just for humans, he included the animal reproduction rates as well.

  The idea of the population growing faster than the production of food that Thomas Malthus proposed really intrigued Charles Darwin. Malthus influenced Darwin's idea of "survival of the fittest" and helped inspire his Theory of Natural Selection.  Thomas Malthus was very influential to Charles Darwin because his idea of over population would be a key study in Darwin's study of the "Galapagos Finches".

                 

Below are a few links that will further describe Thomas 

Malthus and his influence on Charles Darwin's studies.

http://www.buzzle.com/articles/thomas-malthus-theory

http://www.allaboutscience.org/malthus-faq.htm

How does Evolution work?

The point that was most directly affected by Thomas Malthus's work :

• Resources are limited.

-     This point is pretty self-explanatory in the sense of why it would be affected by Malthus's work. Since he was an economist, he understood the concept of population and how it would grow and decline. He believed that the larger the population, the more scarce the food supply will be. He stated that poor families should not be the ones to have big families because they cannot provide due to "limited resources". It makes perfect sense, and we see this now today in the world. The cause for a number of deaths such as, starvation and disease would eventually level-out the over population at this period of time and it was all because of "limited resources". This idea had a very positive effect on Charles Darwin's studies.   

Could Darwin have developed his theory of natural selection without the influence and ideas of Thomas Malthus?

            -  The answer is yes. Charles Darwin developed his studies and theories from other people, not just Thomas Malthus. Even though Malthus was a huge contributor to the influence of Darwin's theory of natural selection, it wasn't the catalyst that started it all. Darwin would have developed his theories without help from the ones who influenced his studies, but some provided evidence to give him a helping hand.

How did the attitude of the church affect Darwin and his eventual publication of his book On The Origin of Species? 

           -  The attitude of the church towards Charles Darwin was affect positively and negatively. Some of the people of the church actually believed in what Darwin had to say. However there were other people of the church who thought his ideas were going against God and were wrong and unethical. So to say the church affected Darwin would be debatable because although he did have some against his studies, he also had believers in what he was doing.