Tuesday, July 29, 2014

------------The Language Experiment ------------




                 This language experiment was quite difficult. It was hard for me in particular because my girlfriend says I talk a lot. So for me to be quiet for 15 minutes without saying a word was a hard task. She can interpret my body language and hand movements, but without being able to hear me say a word did make things a bit difficult to understand completely. I felt that the conversation began to get frustrated for the both of us when she wasn't able to understand my body language accurately. If my girlfriend and I were from two different cultures meeting for the first time, and my only form of communication was body language, hand signs, and other forms that were not vocalized or sign language; I feel she would have some sort of empowerment over me for the simple fact that she would be able to express complex ideas and I wouldn't be able to effectively communicate back. There are some individuals, such as deaf, elders with hearing loss, children with disabilities that have trouble communicating and understanding sign language, and not only the speaker, but these individuals will become frustrated by not being able to understand or be understood. These individuals may began to feel of less importance because they can not be understood properly. 


For the next part of the experiment, I was not able to last the full 15 minutes communicating without and facial expressions, body movements, or hand signals. I felt that the most difficult part was not moving my head or eyebrows. I never realized how hard it was to not nod my head or raise my eyebrows before. I could talk for a few minutes until I was able to get into the conversation and catch myself raising an eyebrow. My girlfriend seemed not as interested in our conversation after a few minutes, due to the fact that I showed no interest myself without any facial expressions or or body movements so the conversation turned into just a flowing conversation with no point. This experiment shows us just how much our body language, signs, and facial expressions really keep the listener in tune with us and interested about the topic. With limitations we tend to lose the listeners attention because we are making the conversation boring. I feel everyone has difficulties reading body language to some extent. Just thin about a time when you are across a store or a room at a party, and you are trying to say something to your friend and they were not able to interpret your form of communication, the frustration will set in and eventually one person will walk over to the other and ask, "what did you say?", and this experiment shows that. When people can interpret body language effectively in conversations, the speaker is shown that they are being understood and they are having a quality conversation. 

An environmental condition where it would NOT be beneficial to interpret body language would be in front of a jury in a courthouse when you are trial defending yourself and your actions. You would not want someone to think you are lying by your body language if your nervous and it shows. They might interpret your body language as defensive instead of nervousness. 
This experiment was quite interesting to participate in and think about in general because it makes you realize just how much body language and other ways factor into communication with others. 


Tuesday, July 15, 2014

- The Piltdown Man -

The Greatest Hoax In Scientific History.



In 1912 researchers around the world were intensely searching for what was called, the "missing link" between apes and humans. Charles Darwin had published "On the Origin of Species" just 53 years previously. In parts of Europe, fossils were found of early humans. A main part of Europe that was being over looked by the evidence found in Germany and France were the British Isles.


        Then, in early 1912, an archaeologist by the name of Charles Dawson, had written a letter to the head keeper of Geology at the Natural History Museum. Dawson wrote in the letter that he was claiming to have found evidence of a piece of thick human-like skull in gravel beds at Piltdown in Sussex, England. The news of this shocking, yet exciting discovery, brought the head keeper Arthur Smith Woodward and Charles Dawson together to team up and they began the search for more evidence. In their findings, they came across more skull fragments, a jawbone with 2 teeth, and different animal fossils and some stone tools. As you may guess, these were used as evidence of early human life know as "The Piltdown Man". Arthur Woodward believed the two fragments of the skull and jawbone to be of the same individual. With the evidence, Woodward made a reconstructed skull. The large portion of the skull at this time was thought to indicate a level of intelligence, this was to set it apart from the apes skull. The jawbone resembled an ape but the teeth resembled humans teeth. Dawson and Woodward believed the evidence of the skull was of a human from over 500,000 years ago. The new specimen was named by Arthur Woodward as Eoanthropus dawsoni - Dawson's Dawn Man.


       At the end of 1912 at a large Geology meeting, Arthur Smith Woodward felt it was time to announce their discovery to the rest of the world. For the most part everyone was convinced the findings to be real. In 1913, a canine tooth was discovered to provide more evidence. Dawson, even claimed to have found more canine teeth and skull fragments near the site of the original findings. However, in 1916 Dawson passed away and since then, there has yet to be any findings of further evidence.
              As years passed, more and more human fossils and the discoveries of these skulls began to resemble apes while the jaws resemble humans. This began to throw up red flags to the findings of Dawson. At a point in the 1920's in almost every article regarding science, there were parts regarding the findings of Dawson. However, as more and more of the fossils were found that didn't match up with Dawson's findings , the less the Piltdown Man was even talked about. As more and more red flags came up and as technology advanced, tested were ran on the Piltdown Man.


(J.S. Weiner and Kenneth Oakley taking Fluorine tests)

            In 1953, Dr. Joseph S. Weiner, along with Sir Wilfrid Le Gros Clark and Kenneth Oakley, ran forensic test on the fossils. It did not take long for them to find out the fossils were fraudulent when they observed them closely under a microscope. They saw the skull was of a 500-year old human, the jaw was from a chimpanzee or orangutan , and the teeth were of an ancient elephant or hippo that they had fied down to resemble human teeth and look worn to the eye. The bones have been stained to look old. The jaw was actually broken so it would fit on the human skull. These findings would make viewers of science be skeptical of findings ever since the Piltdown Man was determined as a hoax.

The impact of the hoax would impact the scientific process by making the deniers of science use this as an example to state that science is just looking for evidence that researchers are so eager because they accepted false evidence in order to prove the  Biblical creation myth wrong.

A positive impact for revealing the Piltdown Man a hoax, would be a reason for the fossils not to be found as a fraud earlier was due to the inability to use technology to determine the fossils false and the lack of knowledge of the skulls. An argument can be that the  fossils only amounted to a hypothesis at best about human evolution. Scientist were able to investigate the hypothesis and determine it to be false due to evidence, which was tampered with. So just because a few early scientist made fraud evidence doesn't mean the value of the other scientist should have to be overshadowed.

Scientist in the late 1940's and early 1950's used fluorine tests, to determine that the fossils were only 50,000 years old which would falsify the ability for them to be 500,000 years old. The used the scientific method to determine the falsity of the evidence.



Is it possible to remove the “human” factor from science to reduce the chance of errors like this 
happening again? Would you want to remove the human factor from science?

    - No , I believe that the errors will not decrease because human factor plays a huge part in evolution. I would not want to remove the human factor because technology today because scientist have the knowledge and the technology to provide accurate data.

Life Lesson: What lesson can you take from this historical event regarding taking information at face value from unverified sources? 

     - To always see the bigger picture and not completely focus just on the little details. It is not a bad thing to focus on the details of things, but when its all you focus on, then the main goal or picture gets overlooked because we start to worry about the wrong things when the problem is right in front of us.        





Friday, July 4, 2014

-----------------Analogy/Homology ----------------

Two species that possess the same homologous traits would be:

- Horses and Zebras -





                A horse comes from the family Equidae. Horses have evolved over the past 55 million years. Humans began to domesticate horses back in 4000BC. A horses anatomy enables them to use their speed to escape from predators and they have an  amazing developed sense of balance. Horses are capable of sleeping by standing or lying down. A horses life span ranges from 25 - 30 years. The size of a horse varies and is also influenced by nutrition intake. Horses have 64 chromosomes and contains 2.7 billion DNA pairs which is larger than a dogs genome, but smaller than a human. The horse has an average of 205 bones in its skeletal system. 




              Another species that possesses the same homologous trait would be a Zebra. A zebra also come from the family Equidae. A zebra has their distinctive black and white stripes. The name Zebra perhaps originates from the Latin word equiferus meaning "wild horse". The stripes on a zebra go vertical for the most part, as it may help hide them in grass by disrupting its outline. The stripes may also help to confuse a predator, for instance, if a group of zebras are standing close together, from a distance it may seem to a predator that they are a much larger group due to the stripes and colors and how they seem close together. Zebras have excellent eye sight. Like horses, zebras can turn their ears in alomost any direction. 






The difference in the homologous trait of both the horse and zebra...

Apart form the size, shape and stripes, there are a number of distinguishing features between a horses and zebras. 

1. The bone structure of both the animals is different. Zebras have a solid tail unlike a horses.

2. The anatomy of a horse makes them use speed to run away from predators. They have a well developed sense of balance. Like horses, zebras walk, trot, canter and gallop. They are generally slower than horses, but their great stamina helps them outpace predators. When chased, a zebra will zig-zag from side to side, making it more difficult for the predator. When cornered the zebra will rear up and kick or bite its attacker.

3. Zebras have excellent eyesight. It is believed that they can see in color. Zebras also have night vision, although not as advanced as that of most of their predators.

4. Zebras have excellent hearing, and tend to have larger, rounder ears than horses. Like horses and other ungulates, zebra can turn their ears in almost any direction. In addition to eyesight and hearing, zebras have an acute sense of smell and taste.

5. Female zebras mature earlier than the males, and a mare may have her first foal by the age of three. Males are not able to breed until the age of five or six. Mares may give birth to one foal every twelve months. She nurses the foal for up to a year. Like horses, zebras are able to stand, walk and suckle shortly after they are born. A zebra foal is brown and white instead of black and white at birth.



The early ancestors of the modern horse walked on several spread-out toes, an accommodation to life spent walking on the soft, moist grounds of primeval forests. As species who preferred grass began to appear, the diets shifted from foliage to grasses, leading to larger and more durable teeth. At the same time, as the climate and terrain changed, the horse's predecessors needed to be capable of greater speeds to outrun predators. This was attained through the lengthening of limbs and the lifting of some toes from the ground in such a way that the weight of the body was gradually placed on one of the longest toes, the third.



Two species that possess the same homologous traits would be:

- Platypus & Duck -  


               Although ducks are birds and platypuses are mammals, they have a limited number of similarities. Both are warmblooded vertebrates that breathe using lungs and a respiratory system. Ducks and platypuses both lay eggs, although ducks lay hard-shelled eggs and platypuses lay soft-shelled, leathery eggs. Ducks and platypuses both have a bill, but the platypus's bill is broader and flatter than a duck's bill, and it is equipped with electro-receptors for detecting tiny electrical impulses from crustaceans and larvae that live on the bottom of creeks and rivers. Both ducks and platypuses make frequent dives to find food. In the case of the platypus, however, it will make hundreds of dives a day in order to find the food it needs. Both creatures have webbed feet, but again there is a difference, because the webbing on platypuses feet is retractable, allowing them to use their sharp claws to dig burrows.


A duck is a bird. It has feathers and can fly. A Platypus is a completely different animal. It is a monotreme (egg-laying mammal) with a bill, fur and a thick, beaver-like tail.
                                         
 Other differences include:


  • The platypus's bill is flatter and broader than a duck's, and serves a quite different function. It is equipped with electroreceptors, with which it detects the electrical impulses of tiny crustaceans, and it uses its bill to shovel away the dirt and mud to reach its food. The platypus is completely carnivorous, but a duck is omnivorous, feeding on aquatic plant life as well as insects, small fish, worms and small amphibians. While ducks have permanently webbed feet, the platypus has retractable webbing on its feet. The webbing is there to help it swim, but it retracts when the platypus needs to dig its burrow. Platypuses live and raise their young in burrows dug in the side of riverbanks. Ducks do not burrow, but build nests in which to lay their eggs. Platypuses are unique to Australia. Ducks are found all over the world. Ducks migrate; platypuses do not.









  • Thursday, June 26, 2014

    ------------- Protein Synthesis/DNA ------------

    -DECODE DNA BELOW-

    GOOD LUCK!

    ACTGGTACCACCCGAACGTTAATCACGGGAACAGACCTATGTATAACTATATCTAAGC




    Thursday, June 19, 2014

    Historical Influences on Charles Darwin

    Thomas Robert Malthus 

    Feb. 14, 1766-Dec. 29, 1834

       Thomas Robert Malthus was an economist for Britain and I believe tremendously influenced the ideas that contributed to the studies of Charles Darwin. Malthus who is best known for his theory that the growth of population will always outgrow the growth of the food supply. He was the first man to publicly predicted the limits of the human population. Malthus believed that if society became over populated, it would reach a point to where the reproduction of the population would over pass the production of food to feed the society causing death and disease. Malthus also believed that "man" is lazy. In a sense that "man" feels that his duty is to provide for his family and make sure food is on the table. If a man works just to be able to have food every night that he will be satisfied and get complacent and not feel the need to work harder because he is meeting his needs and views. His idea of population growth wasn't just for humans, he included the animal reproduction rates as well.



      The idea of the population growing faster than the production of food that Thomas Malthus proposed really intrigued Charles Darwin. Malthus influenced Darwin's idea of "survival of the fittest" and helped inspire his Theory of Natural Selection.  Thomas Malthus was very influential to Charles Darwin because his idea of over population would be a key study in Darwin's study of the "Galapagos Finches".
                     




    Below are a few links that will further describe Thomas 
    Malthus and his influence on Charles Darwin's studies.






    How does Evolution work?

    The point that was most directly affected by Thomas Malthus's work :
    • Resources are limited.
    -     This point is pretty self-explanatory in the sense of why it would be affected by Malthus's work. Since he was an economist, he understood the concept of population and how it would grow and decline. He believed that the larger the population, the more scarce the food supply will be. He stated that poor families should not be the ones to have big families because they cannot provide due to "limited resources". It makes perfect sense, and we see this now today in the world. The cause for a number of deaths such as, starvation and disease would eventually level-out the over population at this period of time and it was all because of "limited resources". This idea had a very positive effect on Charles Darwin's studies.   


    Could Darwin have developed his theory of natural selection without the influence and ideas of Thomas Malthus?

                -  The answer is yes. Charles Darwin developed his studies and theories from other people, not just Thomas Malthus. Even though Malthus was a huge contributor to the influence of Darwin's theory of natural selection, it wasn't the catalyst that started it all. Darwin would have developed his theories without help from the ones who influenced his studies, but some provided evidence to give him a helping hand.

    How did the attitude of the church affect Darwin and his eventual publication of his book On The Origin of Species? 

               -  The attitude of the church towards Charles Darwin was affect positively and negatively. Some of the people of the church actually believed in what Darwin had to say. However there were other people of the church who thought his ideas were going against God and were wrong and unethical. So to say the church affected Darwin would be debatable because although he did have some against his studies, he also had believers in what he was doing.